IMIS | Flanders Marine Institute
 

Flanders Marine Institute

Platform for marine research

IMIS

Publications | Institutes | Persons | Datasets | Projects | Maps
[ report an error in this record ] Print this page

Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains
Citation
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4 https://doi.org/10.15468/ulq7je
Contact: Tytgat, Bjorn

Access data
Archived data
Availability: Creative Commons License This dataset is licensed under a Creative Commons Attribution 4.0 International License.

Description
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2. more

Geographic coverage: Sor Ronda Mountains, East Antarctica
Taxonomic coverage: 16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8-27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536-516).

Scope
Themes:
Biology > Organic (& bio-) chemistry
Keywords:
Terrestrial, Metadata, Sequencing, Soil, Antarctica, Bacteria

Geographical coverage
Antarctica [Marine Regions]

Temporal coverage
1 January 2009 - 1 January 2010

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Molecular data

Contributors
Universiteit Gent (UGent), moredata creator

Related datasets
Published in:
AntOBIS: Antarctic Ocean Biodiversity Information System, more

Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2018-12-04
Information last updated: 2019-04-10
All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy