IMIS | Flanders Marine Institute
 

Flanders Marine Institute

Platform for marine research

IMIS

Publications | Institutes | Persons | Datasets | Projects | Maps
[ report an error in this record ] Print this page

Microbial population dynamics along a terrestrial Antarctic moisture gradient
Citation
Lee K, Caruso T, Archer S, Gillman L, Lau M, Cary C, lee C, Pointing S (2019): Microbial population dynamics along a terrestrial Antarctic moisture gradient. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=microbes_terrestrial_antarctic_moisture_gradient&v=1.2 https://dx.doi.org/10.15468/ypn3qm
Contact: Lee, Kevin

Access data
Archived data
Availability: Creative Commons License This dataset is licensed under a Creative Commons Attribution 4.0 International License.

Description
Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA gene) in soil samples from the McMurdo Dry Valleys (Antarctica) taken along a moisture gradient. more

We adopted a zonal sampling approach where soils were retrieved that matched visible delineations along linear transects extending across the hyporheic zone from the water’s edge at each sampling station: Zone (1) Saturated soil adjacent to water’s edge; Zone (2) Wet soil as indicated by dark coloration; Zone (3) Ephemerally wet soil, dry but with evidence for previous water indicated by surface evaporites; Zone (4) Dry soil with no indication of recent moisture. Soils from each zone in each transect were recovered using aseptic technique and saturated with Lifeguard solution (Qiagen, Netherlands) (n = 16) with parallel sampling for geochemical and moisture analysis (n = 16). All samples were stored in darkness frozen at -20oC until processed.
Study Extent: Sampling was conducted around the hyporheic zone of Spaulding Pond, Taylor Valley in the McMurdo Dry Valleys of Antarctica, during the austral summer of 2015. Four transects were defined in north-east (S77◦ 39.489′ , E163◦ 07.501′ ), south-east (S77◦ 39.513′ , E◦ 163 07.626′ ), south (S77◦ 39.589′ , E◦ 163 07.006′ ), and north-west (S77◦ 39.470′, E◦163 06.336′) facing hyporheic moisture gradients.
Method step description:
  1. Samples were thawed on ice and three 0.5 g extractions were conducted using the CTAB method optimized for Antarctic oligotrophic environmental samples (Archer et al., 2015). DNA yield was measured in ng/g soil. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, United States) as previously described (Lee et al., 2016). PCR targeting the V3–V4 regions of bacterial and archaeal 16S rRNA gene with the primer set: PCR1 forward (5′ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3′ ) and PCR1 reverse (5′ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3′) was conducted using KAPA HiFi Hotstart Readymix (Kapa Biosystems, Wilmington, MA, United States) and the following thermocycles: (1) 95◦C for 3 min, (2) 25 cycles of 95◦C for 30 s, 55◦C for 30 s, ◦C for 30 s, 72◦C for 5 min, and (3) holding the samples at 4◦C. The amplicons were then indexed using Nextera XT index kit (Illumina). AMPure XP beads (Beckman-Coulter, Brea, CA, United States) was used to purified the amplicon. Sequencing was conducted with an Illumina MiSeq system (Illumina) with the 500 cycle V2chemistry at Auckland University of Technology, New Zealand. A 5% PhiX spike-in was used, as per manufacturer’s recommendation.

Scope
Keywords:
Terrestrial, Dna sequencing, Metadata, Antarctica, Victoria Land, McMurdo Dry Valleys, Bacteria

Geographical coverage
Antarctica, Victoria Land, McMurdo Dry Valleys [Marine Regions]

Temporal coverage
2015

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Molecular data

Contributors
Auckland University of Technology, moredata creator
National University of Singapore (NUS), moredata creator
Queen's University Belfast, moredata creator
University of Waikato, moredata creator

Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2019-04-04
Information last updated: 2019-04-10
All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy