Publications | Institutes | Persons | Datasets | Projects | Maps
[ report an error in this record ] Print this page

Microbial soil Fungi (ITS2) diversity from Maritime Antarctica
Citation
Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P (2019): Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=soil_fungi_its2_maritime_antarctica&v=1.2 https://doi.org/10.15468/fdh2mt

Access data
Archived data
Availability: Creative Commons License This dataset is licensed under a Creative Commons Attribution 4.0 International License.

Description
Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands. more

The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.
Study Extent: Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica.
Method step description:
  1. Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.

Scope
Keywords:
Terrestrial · Antarctica · Dna sequencing · Metadata · Fungi

Geographical coverage
Antarctica Stations [Marine Regions]
Antarctic Peninsula and Maritime Antarctic Islands

Taxonomic coverage
Fungi [WoRMS]

Parameter
Molecular data

Contributors
Natural Environment Research Council; British Antarctic Survey (BAS), moredata creator
Royal Agricultural University, moredata creator
The University of Queensland (UQ), moredata creator
Newcastle University, moredata creator
University of Western Australia (UWA), moredata creator

Related datasets
Published in:
AntOBIS: Antarctic Ocean Biodiversity Information System, more
(Partly) included in:
RAS: Register of Antarctic Species, more

Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2019-04-04
Information last updated: 2019-04-10
All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy