[ report an error in this record ]basket (0): add | show Print this page

Reassessment of mud crab (Scylla spp.) taxonomic identity in Segara Anakan Lagoon, Cilacap, Indonesia
Fauziyah, A.; Ahmad, I.; Dwiartama, A.; Kochzius, M. (2024). Reassessment of mud crab (Scylla spp.) taxonomic identity in Segara Anakan Lagoon, Cilacap, Indonesia, in: Mees, J. et al. Book of abstracts – VLIZ Marine Science Day, 6 March 2024, Oostende. VLIZ Special Publication, 91: pp. 73
In: Mees, J.; Seys, J. (Ed.) (2024). Book of abstracts – VLIZ Marine Science Day, 6 March 2024, Oostende. VLIZ Special Publication, 91. Flanders Marine Institute (VLIZ): Oostende. vii + 130 pp. https://dx.doi.org/10.48470/71
In: VLIZ Special Publication. Vlaams Instituut voor de Zee (VLIZ): Oostende. ISSN 1377-0950

Available in  Authors 
Document type: Summary

Keywords
    Scylla De Haan, 1833 [WoRMS]
    Marine/Coastal
Author keywords
    Taxonomic Misidentification, Morphometrical Analysis, DNA Barcoding

Authors  Top 
  • Fauziyah, A.
  • Ahmad, I.
  • Dwiartama, A.
  • Kochzius, M.

Abstract
    Due to high morphological similarity, taxonomic misidentification of the commercially important mud crabs from the genus Scylla is common. Studies from Segara Anakan Lagoon (SAL) (Cilacap, Indonesia) mostly recognised Scylla serrata as the only existing mud crab species in the area. Misidentification of Scylla spp. derived from only using a morphological approach to identify the species.This study aimed to reassess mud crabs (Scylla spp.) in SAL using morphometrical analysis, complemented with DNA barcoding. One hundred and seven specimens were collected from SAL in March-June 2021. Fourteen morphometric parameters were measured using a digital vernier caliper (0.01 mm). The DNA barcoding targeted a fragment of the mitochondrial cytochrome oxidase I (mtCOI) gene, which was amplified by PCR using the primers mtd10 5'TTGATTTTTTGGTCATCCAGAAGT 3' and C/N 2769 5' TTAAGTCCTAGAAATGTTRGGGA 3’.The Neighbour-Joining Tree (NJT) of the COI sequences clustered the four species of Scylla. However the Non-Metric Multidimensional Scaling (nMDS) showed no clusters of the morphometrical data. Regardless the similarity in the morphometrics, the mtCOI sequences revealed that four species of Scylla spp. were present in SAL, contrasting previous findings that only Scylla serrata is present. Sequences-based NJT showed four distinct clades (bootstrap value = 100). Each clade corresponded to different Barcode Identifier Number (BIN) codes obtained from the Barcode of Life Data System (BOLD) during genetic identity verification. The genetic distance (Ds) values between species were higher compared to the within species (0.068-0.173 > 0.002 to 0.004), confirming there were no cryptic species found in the samples. This study indicated that all four Scylla species, i.e S. serrata, S. olivacea, S. tranquebarica, and S. paramamosain were present in SAL.

All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy Top | Authors 



Web site hosted and maintained by Flanders Marine Institute (VLIZ)
Webmaster info@vliz.be
Number of visitors: 2708995 - Total hits: 10369189 (since 2006-01-17)